Journal: PLoS Pathogens

Article Title: Nuclear PYHIN proteins target the host transcription factor Sp1 thereby restricting HIV-1 in human macrophages and CD4+ T cells

doi: 10.1371/journal.ppat.1008752

Figure Lengend Snippet: Endogenous IFI16 inhibits HIV-1 in primary CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post-activation, cells were transfected with Cas9 in complex with either a non-targeting (nt) or an IFI16-specific gRNA. At 96 hours post-transfection, cells were transduced with the indicated VSV-G pseudotyped HIV-1 strains. (A-D) The reduction of IFI16 protein levels in infected cell cultures (A), the infectious virus yield (B), p24 antigen production (C) and levels of viral RNA transcripts (D) were determined by Western blot, TZM-bl infection assay, ELISA and qRT-PCR, respectively, three days post infection. Bar diagrams in panel A and D show mean values (±SD) of the three different donors; those in panel B and C from triplicate measurements. Numbers above bars indicate n-fold change between cells treated with control or IFI16 specific gRNA. * p <0.05, ** p <0.01, *** p <0.001. (E) Association of Sp1 and IFI16 by in situ PLA. (F) Sp1 co-precipitates with IFI16 and PYHIN in CD4 + T lymphocytes. Cells from three healthy donors were isolated and activated with IL-2 and anti-CD3/CD28 beads. 72 hours post activation, cells were lysed and endogenous Sp1 was immunoprecipitated using magnetic beads coated with either an Sp1 antibody or control IgG. Co-IP eluates and input controls were subsequently analysed by Western Blotting. Shown is the blot of one representative experiment. On the right-hand panel, the IFI16 signal intensity from three independent experiment (±SEM) is shown.

Article Snippet: Alternatively, 1*10 6 cells were transfected with the HiFi Cas9 Nuclease V3 (IDT)/gRNA complex (80 pmol/300 pml) (Lonza) using a non-targeting (IDT (ACGGAGGCTAAGCGTCGCAA)) or an IFI16-specific (IDT (GACCAGCCCTATCAAGAAAG)) sgRNAs, using the Amaxa 4D-Nucleofector Human Activated T Cell P3 Lonza Kit (Lonza), pulse code EO115.

Techniques: Isolation, Activation Assay, Transfection, Transduction, Infection, Virus, Western Blot, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Control, In Situ, Immunoprecipitation, Magnetic Beads, Co-Immunoprecipitation Assay

Journal: Molecular Therapy. Nucleic Acids

Article Title: Inhibition of adenovirus replication by CRISPR-Cas9-mediated targeting of the viral E1A gene

doi: 10.1016/j.omtn.2023.02.033

Figure Lengend Snippet: Structure of the recombinant adenovirus vector constructs and gRNA sequences incorporated into them (A) Schematic of HAdV-5-based vectors with inserted individual gRNA sequences. All adenoviral vectors are based on the HAdV-5-derived vector pAd/PL-DEST (Thermo Fisher Scientific) and lack the E1 and E3 regions. Cas9 and gRNA expression cassettes were inserted into the deleted E1 region. The expression of spCas9-HF1 is driven by a tetracycline repressor-controlled CMV promoter comprising two binding sites for the repressor (2×TetO2). The expression of the individual targeting or non-targeting gRNAs is under control of a constitutive human U6 (hU6) promoter. The structure and sequence of the gRNAs are exemplarily shown for E1A gRNA 9 bound to its target site. The control vector containing only the Cas9 expression cassette is also depicted. (B) Target sequences for the individual gRNAs and their positions within the HAdV-5 genome (AY339865.1).

Article Snippet: Linear DNA fragments (gBLOCKS) containing individual targeting or non-targeting gRNAs under control of a human U6 promoter were generated by gene synthesis (Integrated DNA Technologies, Coralville, IA, USA), and the individual expression cassettes were inserted into the Hind II and NotI sites of the SpCas9-HF1 expression cassette-containing intermediate vector, giving rise to vectors pENTR-CMV-TetO2-spCas9-HF1-hU6-gRNA 1–10, containing a single targeting gRNA each, and to the control vectors containing non-targeting gRNAs (pENTR-CMV-TetO2-spCas9-HF1-hU6-NT gRNA) or containing only the spCas9-HF1 expression cassette (pENTR-CMV-TetO2-spCas9-HF1).

Techniques: Recombinant, Plasmid Preparation, Construct, Derivative Assay, Expressing, Binding Assay, Control, Sequencing